0
We're unable to sign you in at this time. Please try again in a few minutes.
Retry
We were able to sign you in, but your subscription(s) could not be found. Please try again in a few minutes.
Retry
There may be a problem with your account. Please contact the AMA Service Center to resolve this issue.
Contact the AMA Service Center:
Telephone: 1 (800) 262-2350 or 1 (312) 670-7827  *   Email: subscriptions@jamanetwork.com
Error Message ......
Original Article |

Evaluating Revascularization and Flap Survival Using Vascular Endothelial Growth Factor in an Irradiated Rat Model FREE

Patrick C. Angelos, MD; Shelley R. Winn, PhD; Darryl S. Kaurin, PhD; John Holland, MD; Mark K. Wax, MD
[+] Author Affiliations

Author Affiliations: Departments of Otolaryngology–Head and Neck Surgery (Drs Angelos, Winn, and Wax) and Radiation Oncology (Drs Kaurin and Holland), Oregon Health & Science University, Portland.


Arch Facial Plast Surg. 2011;13(3):185-189. doi:10.1001/archfacial.2010.115.
Text Size: A A A
Published online

Reconstruction after salvage surgery for failed radiation or chemoradiation often involves free-tissue transfer and provides a challenge for the surgeon because of the effects of radiation on the host microvasculature. These changes ultimately affect wound healing. Whereas reconstructive flaps may have adequate blood supply to survive, the radiation effects on the host wound bed may delay flap incorporation and revascularization between the flap and host tissue. The effects of radiation therapy on the microvasculature have been described as a decrease in capillary density and diameter as well as excessive fibrosis, endothelial cell damage, and reduced cellular turnover.13

Vascular endothelial growth factor (VEGF) is a potent angiogenic cytokine that induces angiogenesis, stimulates endothelial cells to mitogenic responses, and increases microvascular permeability.4 In the skin, VEGF is secreted by keratinocytes and fibroblasts and is especially active on dermal vascular structures.5 Previously, 2 of us have shown that the topical application of fibrin-embedded VEGF protein enhanced survival of fasciocutaneous flaps in nonirradiated animals.6 Other investigators have also demonstrated improved skin flap survival using VEGF gene therapy in nonirradiated animals.7,8 No previous studies, to our knowledge, have examined the effects of VEGF on flap revascularization in previously irradiated animals. The purpose of this study was to evaluate the effects of topical VEGF pDNA on revascularization of a ventral fasciocutaneous flap in an irradiated rat model.

After Institutional Animal Care and Use Committee review and approval, 28 male Sprague-Dawley rats (Charles River Laboratories International Inc, Wilmington, Massachusetts) received a total dose of 40 Gy electron beam radiation to the ventral abdominal wall. After a 1-month recovery period, the rats underwent a ventral fasciocutaneous flap procedure with a 2-hour ischemia period. The rats were initially divided into 2 groups, an experimental arm to receive VEGF pDNA and a control arm to receive only carriers (Figure 1). The experimental group (n = 14) received topical VEGF pDNA, in vivo cationic polymer (jetPEI; Polyplus-transfection Inc, New York, New York), and fibrin sealant (Tisseel; Baxter International Inc, Deerfield, Illinois). The control group (n = 14) received topical cationic polymer and fibrin sealant only. To evaluate the time course of revascularization, 7 rats from each group underwent pedicle ligation at 8 or 14 days. The primary outcome measure was percentage of flap revascularization measured as area of viable skin 5 days after pedicle ligation.

Place holder to copy figure label and caption
Figure 1.

Study overview.

Graphic Jump Location
RADIATION PROTOCOL

All rats underwent general anesthesia using isoflurane inhalation during radiation. A lead shield was placed to isolate the templated flap region. A 6-MeV electron beam accelerator (Clinac 2100EX; Varian Medical Systems Inc, Palo Alto, California) was used to irradiate the rats. A bolus material of 2 cm on top of the abdomen was used to improve radiation dose distribution. During a 10-day period, radiation was administered in 5 divided doses of 8 cGy each, totaling 40 Gy.

VENTRAL FASCIOCUTANEOUS FLAP PROCEDURE

After a recovery period of 28 days after radiation, the rats underwent a ventral fasciocutaneous flap procedure. A ventral 3 × 6–cm fasciocutaneous flap (Figure 2A) pedicled on the inferior epigastric artery and vein was raised. Following elevation of the flap, a 20-g temporary occlusion clip was applied to the vascular pedicle for 2 hours to simulate the ischemic period during free-tissue transfer (Figure 2B). Prior to flap inset and closure, experimental or control solution was applied topically (Figure 2C). During this period, the flap was inset (Figure 2D) and the rats were awakened from anesthesia. At the end of the 2-hour period of simulated ischemia, the rats were briefly reanesthetized, the corner of the flap was elevated, the occlusion clip was removed, and the wound was reapproximated. The rats were monitored daily for signs of pain and discomfort and treated with analgesics as needed. They then underwent ligation of the inferior epigastric vein and artery at the previously outlined intervals.

Place holder to copy figure label and caption
Figure 2.

Flap procedure overview. A, 3 × 6 cm–Ventral fasciocutaneous flap (outlined in black). B, Temporary occlusion clip on the vascular pedicle at the inferior aspect of the raised flap. C, Application of topical solution via micropipette. D, Closed flap.

Graphic Jump Location
VEGF pDNA AND CARRIERS

Preparation of VEGF pDNA was performed using recombinant polymerase chain reaction technology similar to that previously described.9 The messenger RNA (mRNA) of VEGF with alternate splicing amino acid number 165 (VEGF165) was isolated from U937 histiocytic lymphoma cells (ATCC CRL-1593). Complementary DNA (cDNA) was synthesized from 1-μg polyadenylated RNA by a cDNA synthesis kit (Pharmacia Corporation, Kalamazoo, Michigan). cDNA application via polymerase chain reaction occurred using the VEGF165-specific primers: Forward: 5′GAAACCATGAACTTTCTGCTG and Reverse: 5′TCACCGCCTCGGCTTGTCACA.

This encodes the entire region and includes the signal sequence. The polymerase chain reaction product was ligated to pCEF1α-DNT-IgSP with the Eukaryotic TA Cloning Kit–Unidirectional (Invitrogen, Carlsbad, CA). The ligation mixture was transformed, colonies were selected, and the mixture was sequenced from both directions to ensure appropriate cDNA sequencing (Figure 3). For the present studies, the pDNA expressing the VEGF165 was purified via Qiagen Plasmid Maxi Kits (Qiagen Inc, Valencia, California), and aliquots were nicked at appropriate restriction sites and run on 1% agarose gels for quality assurance.

Place holder to copy figure label and caption
Figure 3.

Plasmid DNA expressing vascular endothelial growth factor (VEGF). The pCEF1α-DNT-IgSP-VEGF plasmid expression vector has a cytomegalovirus (CMV)–enhancer element that upregulates the elongation factor 1-α (EF1-α) promoter. The circular plasmid DNA construct contains ampicillin resistance for bacterial expansion and a neomycin analogue that confers resistance for selection in eukaryotic systems. Numbers in parentheses correspond to the specific base pair site(s) in the sequence of the location of the restriction endonuclease sites. AMPR indicates ampicillin resistant, HBV 3′UT, hepatitis virus B 3′ untranslated region; IgSP, immunoglobulin signal peptide; mDHFR, mouse dihydrofolate reductase; Neo R, neomycin resistance; Nhe I, restriction endonuclease site; and pA, polyadenylation.

Graphic Jump Location

After the vascular clip was applied, the rats were given 1 of 2 treatments. The control group was treated with a buffered solution in a polycation complex (in vivo cationic polymer) and further suspended in fibrin sealant. The experimental group received 100 μg of pDNA-expressing, VEGF-condensed cationic polymer and further suspended in fibrin sealant. One milliliter of the viscous solutions was evenly distributed over the exterior surface of the 3 × 6–cm elevated flap.

EVALUATION OF FLAP REVASCULARIZATION

Percentage of flap viability was evaluated on postligation procedure day 5 as a marker for flap revascularization. Viable flap area was characterized by warm, pink, hair-bearing skin. Nonviable flap area was characterized by dry, hard, hairless eschar. The rats were given general anesthesia, and standardized digital photographs of the ventral flap were taken. Three qualified masked observers were used to delineate viable and nonviable areas by tracing template etchings. Then, cutouts of viable tissue from the template were weighed to express a percentage of the total template weight, which effectively gave the area percentage of viable flap tissue. Rats were excluded for evaluation if they developed a clinically significant hematoma, seroma, or infection.

STATISTICAL ANALYSIS

To determine the number of rats needed, a power analysis was performed using our preliminary data; it indicated that a minimum of 6 rats for each group would be required to complete a meaningful statistical analysis of flap revascularization to obtain P < .05 of significance. A Mann-Whitney test was used to evaluate whether a difference in percentage of flap viability existed between the experimental and control groups at 8 and 14 days to pedicle ligation.

We observed varying degrees of revascularization between the 4 groups, with a trend toward increased revascularization in the 2 groups with longer duration to pedicle ligation (Figure 4). Rats receiving VEGF pDNA had a significantly higher rate of flap revascularization (90.8% vs 79.8%) after pedicle ligation at 14 days (P = .045). At 8 days, rats receiving VEGF pDNA (group 1) had an increased rate of flap revascularization (58.2% vs 42.8%) that approached significance (P = .11). One rat from each of the 4 groups developed a seroma, and those rats were excluded from analysis.

Place holder to copy figure label and caption
Figure 4.

Average percentage flap revascularization results by group (mean percentage). The day number corresponds to day of pedicle ligation. Exp indicates the experimental group.

Graphic Jump Location

Microvascular reconstruction after salvage surgery for failed radiation or chemoradiation is a difficult challenge. The long-term viability and healing of a reconstructive flap is not only dependent on the vascular pedicle but also on revascularization from the surrounding host tissue. It has been shown that previous radiation therapy leads to microvascular compromise in the host tissue that manifests as excessive fibrosis, endothelial cell damage, and reduced cellular turnover.1,3 Because of these effects on the host tissue, revascularization between an irradiated wound bed and a reconstructive flap may be diminished.

Vascular endothelial growth factor is an attractive agent for potential therapeutic application because it may improve the microvasculature in previously irradiated tissue and, in turn, the revascularization of remote flap tissue. Several previous studies have evaluated the effects of exogenous VEGF application on skin graft survival.4,7,8,1013 These studies include evaluation of local and systemic application of VEGF protein or VEGF pDNA in various vectors. In a previous study, 2 of us6 evaluated the ability of topical application of fibrin-embedded VEGF pDNA and VEGF protein to enhance revascularization and survival of fasciocutaneous flaps in nonirradiated animals. We found that the use of a gene-activated matrix, consisting of pDNA entrapped in a polymer matrix carrier, was an effective method for gene transfer. Studies have shown that matrix carriers serve as a scaffold to hold DNA in situ until endogenous fibroblasts arrive.14,15 Other studies have also shown that fibrin-embedded administration of VEGF pDNA does not influence its angiogenic properties but enhances skin flap survival.8,16

In the present study, we have shown that topical application of VEGF pDNA significantly improves revascularization of a ventral fasciocutaneous flap in an irradiated rat model after pedicle ligation at 14 days postoperatively. At 8 days postoperatively, we found that VEGF pDNA application did not lead to significantly increased revascularization and flap viability.

Very few previous studies, to our knowledge, have evaluated the effects of VEGF in an irradiated field. In a study of skin graft survival in irradiated rats, Richter et al17 evaluated the effect of local application of VEGF protein. They found that exogenously administered VEGF significantly decreased the graft failure rate but microvascular density was not different between groups. The lack of effect on microvascular density may be due to an increase in newly formed vessels in the recipient bed and not in the transplant bed. Previous studies have also shown similar findings of improved graft survival without a change in vessel density in the transplanted tissue.12,13,18,19

The potential clinical application of this study involves the exogenous use of naturally occurring growth factors and cytokines to augment the protracted wound healing and revascularization of reconstructive flaps in previously irradiated patients. Promising results in soft tissue wound healing may translate into healing in microvascular reconstruction of bone (such as that of the mandible), and further studies are needed for these types of applications. The limitations of this study include a small number of rats in each group; the time between radiation and surgery, which may vary clinically; and the fact that the flap and tissue bed have been irradiated. Typically, the reconstructive flap is taken from a nonirradiated field and brings a fresh blood supply to the wound bed. In this model, previous radiation may affect the revascularization potential of the flap. It will be interesting to see whether future studies demonstrate a change in microvascular density or VEGF mRNA expression in this previously irradiated flap. Long-term studies are needed regarding the potential neoplastic effects or neoplasia potentiating effects of using VEGF gene therapy in a previously cancer-laden wound bed.

Correspondence: Patrick C. Angelos, MD, Department of Otolaryngology–Head and Neck Surgery, Oregon Health & Science University, Mail Code PV01, 3181 SW Sam Jackson Park Rd, Portland, OR 29239 (angelosp@ohsu.edu).

Accepted for Publication: November 1, 2010.

Published Online: January 17, 2011. doi:10.1001/archfacial.2010.115

Author Contributions: Drs Angelos and Wax had full access to all the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. Study concept and design: Angelos, Winn, Kaurin, Holland, and Wax. Acquisition of data: Angelos, Winn, Kaurin, Holland, and Wax. Analysis and interpretation of data: Angelos, Winn, Kaurin, and Wax. Drafting of the manuscript: Angelos and Wax. Critical revision of the manuscript for important intellectual content: Angelos, Winn, Kaurin, Holland, and Wax. Statistical analysis: Angelos and Kaurin. Obtained funding: Angelos and Wax. Administrative, technical, and material support: Winn, Holland, and Wax. Study supervision: Holland and Wax.

Financial Disclosure: None reported.

Denham  JWHauer-Jensen  M The radiotherapeutic injury—a complex “wound.” Radiother Oncol 2002;63 (2) 129- 145
PubMed
Doll  CDurand  RGrulkey  WSayer  SOlivotto  I Functional assessment of cutaneous microvasculature after radiation. Radiother Oncol 1999;51 (1) 67- 70
PubMed
Dormand  ELBanwell  PEGoodacre  TE Radiotherapy and wound healing. Int Wound J 2005;2 (2) 112- 127
PubMed
Scalise  ATucci  MGLucarini  G  et al.  Local rh-VEGF administration enhances skin flap survival more than other types of rh-VEGF administration: a clinical, morphological and immunohistochemical study. Exp Dermatol 2004;13 (11) 682- 690
PubMed
Detmar  MYeo  KTNagy  JA  et al.  Keratinocyte-derived vascular permeability factor (vascular endothelial growth factor) is a potent mitogen for dermal microvascular endothelial cells. J Invest Dermatol 1995;105 (1) 44- 50
PubMed
McKnight  CDWinn  SRGong  XHansen  JEWax  MK Revascularization of rat fasciocutaneous flap using CROSSEAL® with VEGF protein or plasmid DNA expressing VEGF. Otolaryngol Head Neck Surg 2008;139 (2) 245- 249
PubMed
Lubiatowski  PGoldman  CKGurunluoglu  RCarnevale  KSiemionow  M Enhancement of epigastric skin flap survival by adenovirus-mediated VEGF gene therapy. Plast Reconstr Surg 2002;109 (6) 1986- 1993
PubMed
Michlits  WMittermayr  RSchäfer  RRedl  HAharinejad  S Fibrin-embedded administration of VEGF plasmid enhances skin flap survival. Wound Repair Regen 2007;15 (3) 360- 367
PubMed
Winn  SRChen  JCGong  XBartholomew  SVShreenivas  SOzaki  W Non–viral-mediated gene therapy approaches for bone repair. Orthod Craniofac Res 2005;8 (3) 183- 190
PubMed
Khan  AAshrafpour  HHuang  N  et al.  Acute local subcutaneous VEGF165 injection for augmentation of skin flap viability: efficacy and mechanism. Am J Physiol Regul Integr Comp Physiol 2004;287 (5) R1219- R1229
PubMed
Kryger  ZZhang  FDogan  TCheng  CLineaweaver  WCBuncke  HJ The effects of VEGF on survival of a random flap in the rat: examination of various routes of administration. Br J Plast Surg 2000;53 (3) 234- 239
PubMed
O’Toole  GMacKenzie  DLindeman  R  et al.  Vascular endothelial growth factor gene therapy in ischaemic rat skin flaps. Br J Plast Surg 2002;55 (1) 55- 58
PubMed
Taub  PJMarmur  JDZhang  WX  et al.  Locally administered vascular endothelial growth factor cDNA increases survival of ischemic experimental skin flaps. Plast Reconstr Surg 1998;102 (6) 2033- 2039
PubMed
Endo  MKuroda  SKondo  HMaruoka  YOhya  KKasugai  S Bone regeneration by modified gene-activated matrix: effectiveness in segmental tibial defects in rats. Tissue Eng 2006;12 (3) 489- 497
PubMed
Peng  LCheng  XZhuo  R  et al.  Novel gene-activated matrix with embedded chitosan/plasmid DNA nanoparticles encoding PDGF for periodontal tissue engineering. J Biomed Mater Res A 2009;90 (2) 564- 576
PubMed
Jozkowicz  AFügl  ANanobashvili  J  et al.  Delivery of high dose VEGF plasmid using fibrin carrier does not influence its angiogenic potency. Int J Artif Organs 2003;26 (2) 161- 169
PubMed
Richter  GTBowen  T  IIIBoerma  MFan  CYHauer-Jensen  MVural  E Impact of vascular endothelial growth factor on skin graft survival in irradiated rats. Arch Facial Plast Surg 2009;11 (2) 110- 113
PubMed
Banbury  JSiemionow  MPorvasnik  SPetras  SBrowne  E Improved perfusion after subcritical ischemia in muscle flaps treated with vascular endothelial growth factor. Plast Reconstr Surg 2000;106 (7) 1541- 1546
PubMed
Zhang  FOswald  TMLin  LWang  SLin  SLineaweaver  WC Improvement of full-thickness skin graft survival by application of vascular endothelial growth factor in rats. Ann Plast Surg 2008;60 (5) 589- 593
PubMed

Figures

Place holder to copy figure label and caption
Figure 1.

Study overview.

Graphic Jump Location
Place holder to copy figure label and caption
Figure 2.

Flap procedure overview. A, 3 × 6 cm–Ventral fasciocutaneous flap (outlined in black). B, Temporary occlusion clip on the vascular pedicle at the inferior aspect of the raised flap. C, Application of topical solution via micropipette. D, Closed flap.

Graphic Jump Location
Place holder to copy figure label and caption
Figure 3.

Plasmid DNA expressing vascular endothelial growth factor (VEGF). The pCEF1α-DNT-IgSP-VEGF plasmid expression vector has a cytomegalovirus (CMV)–enhancer element that upregulates the elongation factor 1-α (EF1-α) promoter. The circular plasmid DNA construct contains ampicillin resistance for bacterial expansion and a neomycin analogue that confers resistance for selection in eukaryotic systems. Numbers in parentheses correspond to the specific base pair site(s) in the sequence of the location of the restriction endonuclease sites. AMPR indicates ampicillin resistant, HBV 3′UT, hepatitis virus B 3′ untranslated region; IgSP, immunoglobulin signal peptide; mDHFR, mouse dihydrofolate reductase; Neo R, neomycin resistance; Nhe I, restriction endonuclease site; and pA, polyadenylation.

Graphic Jump Location
Place holder to copy figure label and caption
Figure 4.

Average percentage flap revascularization results by group (mean percentage). The day number corresponds to day of pedicle ligation. Exp indicates the experimental group.

Graphic Jump Location

Tables

References

Denham  JWHauer-Jensen  M The radiotherapeutic injury—a complex “wound.” Radiother Oncol 2002;63 (2) 129- 145
PubMed
Doll  CDurand  RGrulkey  WSayer  SOlivotto  I Functional assessment of cutaneous microvasculature after radiation. Radiother Oncol 1999;51 (1) 67- 70
PubMed
Dormand  ELBanwell  PEGoodacre  TE Radiotherapy and wound healing. Int Wound J 2005;2 (2) 112- 127
PubMed
Scalise  ATucci  MGLucarini  G  et al.  Local rh-VEGF administration enhances skin flap survival more than other types of rh-VEGF administration: a clinical, morphological and immunohistochemical study. Exp Dermatol 2004;13 (11) 682- 690
PubMed
Detmar  MYeo  KTNagy  JA  et al.  Keratinocyte-derived vascular permeability factor (vascular endothelial growth factor) is a potent mitogen for dermal microvascular endothelial cells. J Invest Dermatol 1995;105 (1) 44- 50
PubMed
McKnight  CDWinn  SRGong  XHansen  JEWax  MK Revascularization of rat fasciocutaneous flap using CROSSEAL® with VEGF protein or plasmid DNA expressing VEGF. Otolaryngol Head Neck Surg 2008;139 (2) 245- 249
PubMed
Lubiatowski  PGoldman  CKGurunluoglu  RCarnevale  KSiemionow  M Enhancement of epigastric skin flap survival by adenovirus-mediated VEGF gene therapy. Plast Reconstr Surg 2002;109 (6) 1986- 1993
PubMed
Michlits  WMittermayr  RSchäfer  RRedl  HAharinejad  S Fibrin-embedded administration of VEGF plasmid enhances skin flap survival. Wound Repair Regen 2007;15 (3) 360- 367
PubMed
Winn  SRChen  JCGong  XBartholomew  SVShreenivas  SOzaki  W Non–viral-mediated gene therapy approaches for bone repair. Orthod Craniofac Res 2005;8 (3) 183- 190
PubMed
Khan  AAshrafpour  HHuang  N  et al.  Acute local subcutaneous VEGF165 injection for augmentation of skin flap viability: efficacy and mechanism. Am J Physiol Regul Integr Comp Physiol 2004;287 (5) R1219- R1229
PubMed
Kryger  ZZhang  FDogan  TCheng  CLineaweaver  WCBuncke  HJ The effects of VEGF on survival of a random flap in the rat: examination of various routes of administration. Br J Plast Surg 2000;53 (3) 234- 239
PubMed
O’Toole  GMacKenzie  DLindeman  R  et al.  Vascular endothelial growth factor gene therapy in ischaemic rat skin flaps. Br J Plast Surg 2002;55 (1) 55- 58
PubMed
Taub  PJMarmur  JDZhang  WX  et al.  Locally administered vascular endothelial growth factor cDNA increases survival of ischemic experimental skin flaps. Plast Reconstr Surg 1998;102 (6) 2033- 2039
PubMed
Endo  MKuroda  SKondo  HMaruoka  YOhya  KKasugai  S Bone regeneration by modified gene-activated matrix: effectiveness in segmental tibial defects in rats. Tissue Eng 2006;12 (3) 489- 497
PubMed
Peng  LCheng  XZhuo  R  et al.  Novel gene-activated matrix with embedded chitosan/plasmid DNA nanoparticles encoding PDGF for periodontal tissue engineering. J Biomed Mater Res A 2009;90 (2) 564- 576
PubMed
Jozkowicz  AFügl  ANanobashvili  J  et al.  Delivery of high dose VEGF plasmid using fibrin carrier does not influence its angiogenic potency. Int J Artif Organs 2003;26 (2) 161- 169
PubMed
Richter  GTBowen  T  IIIBoerma  MFan  CYHauer-Jensen  MVural  E Impact of vascular endothelial growth factor on skin graft survival in irradiated rats. Arch Facial Plast Surg 2009;11 (2) 110- 113
PubMed
Banbury  JSiemionow  MPorvasnik  SPetras  SBrowne  E Improved perfusion after subcritical ischemia in muscle flaps treated with vascular endothelial growth factor. Plast Reconstr Surg 2000;106 (7) 1541- 1546
PubMed
Zhang  FOswald  TMLin  LWang  SLin  SLineaweaver  WC Improvement of full-thickness skin graft survival by application of vascular endothelial growth factor in rats. Ann Plast Surg 2008;60 (5) 589- 593
PubMed

Correspondence

CME
Meets CME requirements for:
Browse CME for all U.S. States
Accreditation Information
The American Medical Association is accredited by the Accreditation Council for Continuing Medical Education to provide continuing medical education for physicians. The AMA designates this journal-based CME activity for a maximum of 1 AMA PRA Category 1 CreditTM per course. Physicians should claim only the credit commensurate with the extent of their participation in the activity. Physicians who complete the CME course and score at least 80% correct on the quiz are eligible for AMA PRA Category 1 CreditTM.
Note: You must get at least of the answers correct to pass this quiz.
You have not filled in all the answers to complete this quiz
The following questions were not answered:
Sorry, you have unsuccessfully completed this CME quiz with a score of
The following questions were not answered correctly:
Commitment to Change (optional):
Indicate what change(s) you will implement in your practice, if any, based on this CME course.
Your quiz results:
The filled radio buttons indicate your responses. The preferred responses are highlighted
For CME Course: A Proposed Model for Initial Assessment and Management of Acute Heart Failure Syndromes
Indicate what changes(s) you will implement in your practice, if any, based on this CME course.
NOTE:
Citing articles are presented as examples only. In non-demo SCM6 implementation, integration with CrossRef’s "Cited By" API will populate this tab (http://www.crossref.org/citedby.html).
Submit a Comment

Multimedia

Some tools below are only available to our subscribers or users with an online account.

Web of Science® Times Cited: 1

Related Content

Customize your page view by dragging & repositioning the boxes below.

Articles Related By Topic
PubMed Articles